Please note that we will be retiring this old site on Tuesday, August 25th, 2015.
At that point, the URL for www.pseudomonas.com will bring you to our new site currently hosted at beta.pseudomonas.com. We encourage you to visit the new site now and see a more recent set of updated gene annotations and MANY more Pseudomonas strains.
Pseudomonas Genome Database - Annotation for
               Intergenic region 830893..831300bp                
Add this annotation to your clipboard
Key to gene image


View in GBrowse: (?)
Acknowledgements for this annotation
Feature Overview
Strain Pseudomonas aeruginosa PAO1 (Tax ID: 208964) Replicon Pseudomonas aeruginosa PAO1 chromosome, complete genome.
(5688 genes, 6264404 bp) [ RefSeq ]
Feature type intergenic  Genomic location 830893 - 831300
Name   (View this annotation at our new website) Alternate Names
Locus tag Tranposon Mutant Available? No mutants described yet.
Secondary Genomic Features contained in 572405
Name Sequence Start Stop Strand PubMed IDs Cross Reference Other Notes
P4 algU
Retrieve 830906 830955 + RegTransBase40654
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
transcription initiation site
Retrieve 830950 830950 + 7559357
PseudoCAP: 1426431
Method: S1 nuclease mapping
Comment: TSS for P4 promoter
P3 algU
Retrieve 831020 831069 + RegTransBase40653
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
AlgU binding site
Retrieve 831029 831064 + PRODORIC: SI001201
PRODORIC: PM000682
AlgU binding site
Retrieve 831029 831064 + 11807066
PseudoCAP: 1426430
Method: primer extension analysis
transcriptional initiation site (+1)
Retrieve 831064 831064 + PRODORIC: PM000682
transcription initiation site
Retrieve 831064 831064 + 7559357
PseudoCAP: 1426429
Comment: TSS for P3 promoter
Method: S1 nuclease mapping
P2 algU
Retrieve 831093 831142 + RegTransBase40652
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
transcription initiation site
Retrieve 831137 831137 + 7559357
PseudoCAP: 1426428
Comment: TSS for P2 promoter
Method: S1 nuclease mapping
AlgT promoter
Retrieve 831202 831251 + 7961421
RegTransBase86210
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
algU promoter P1
Retrieve 831203 831253 + 7961422
RegTransBase40639
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
P1 algU
Retrieve 831203 831252 + RegTransBase40649
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
algT promoter
Retrieve 831203 831252 + 7644517
RegTransBase44975
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
algT promoter
Retrieve 831203 831252 + 8759865
RegTransBase76188
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
P1 -35 box
Retrieve 831207 831236 + RegTransBase40650
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
AlgU binding site
Retrieve 831213 831248 + PRODORIC: SI001213
PRODORIC: PM000692
AlgU binding site
Retrieve 831213 831248 + 11807066
PseudoCAP: 1426427
Method: primer extension analysis
algT -35 sequence
Retrieve 831215 831252 + 7644517
RegTransBase44976
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
P1 -10 box
Retrieve 831237 831265 + RegTransBase40651
Note: Manually curated from experimental data. Annotation transferred to all sequenced strains of species.
transcriptional initiation site (+1)
Retrieve 831248 831248 + PRODORIC: PM000692
transcription initiation site
Retrieve 831248 831248 + 7559357
PseudoCAP: 1426426
Method: S1 nuclease mapping
Comment: TSS for P1 promoter
Alternate Annotations and Cross-References
KEGG
GBrowse Click GBrowse for a GBrowse View of this and other annotations.
PseudoCyc Click here to view metabolic pathways in PseudoCyc.
DNA Sequence
Upstream 500 BP Region GATCAGGTCGACCGCCACCCGCTGCGACAGCAACTCGATGTTCGGTCGCCGCCGGGCCTGGGCCAGCAAGGTATTGAAGATCGCGGCGCCGGTGGCGTCG
GCGGCATGGATGATGCGCCGGTGGCTGTGCCCGCCTTCGCGGGTCAGGTGGTATTCGAAGCTGCCTTCCTCGTGGTTGTGCTGCTCGTCGCGGGTGAAGG
GCACCCCCTGTTCGATCAGCCACTGGATCGCTTCGCGGCTATGCTCCACGGTGAAGCGCACCGCATCCTCGCGGCACAGGCCGCCACCGGCGACCAGGGT
GTCCTCGACGTGGGATTCCACGGTGTCGGTATCGTCCAGCACGGCGGCCACGCCGCCCTGGGCCCAGTAGGTCGAGCCCTGCGACAGTTCGCCCTTGCTG
AGGACGGCGATGCGCAGGTGTTCCGGAAGGGTCAAGGCCAGACTCAGGCCGGCGGCGCCGCTGCCGATGACCAGTACATCGTGTTGATAATGTTGGCTCA
T


BLAST search against this genome or other genomes in database
Need more than 500 BP? Try our sequence retrieval tool or view intergenic regions in GBrowse.

DNA Sequence GCCCGCATTTCCCCGTGGTGGAGCCCTAGTATATAGAAGGGCCTGGCGGCACAATAGCGCACCCCCGCTGCCGGTCCGGCGGATGAGCTGCGGGCCTGTC
ATCGGCAGGCGTCATCAGAGCGGGGCGATGTAGTGCTGGAACTTTCTTAGACGCATCGGTTCCAAAGCAGGATGCCTGAAGACCTCGTCCGGTTGGCCTA
CCCAGCGGCACAGAGGCCGGGCCCTGAGCCCGATGCAATCCATTTTCGCGGGGCCCGGACACGATGTCCGGGGCCGCACGTCACGAGCGAGGAAAAAACT
CGTGACGCATGCTTGGAGGGGAGAACTTTTGCAAGAAGCCCGAGTCTATCTTGGCAAGACGATTCGCTGGGACGCTCGAAGCTCCTCCAGGTTCGAAGAG
GAGCTTTC


BLAST search against this genome or other genomes in database

Downstream 500 BP region ATGCTAACCCAGGAACAGGATCAGCAACTGGTTGAACGGGTACAGCGCGGAGACAAGCGGGCTTTCGATCTGCTGGTACTGAAATACCAGCACAAGATAC
TGGGATTGATCGTGCGGTTCGTGCACGACGCCCAGGAAGCCCAGGACGTAGCGCAGGAAGCCTTCATCAAGGCATACCGTGCGCTCGGCAATTTCCGCGG
CGATAGTGCTTTTTATACCTGGCTGTATCGGATCGCCATCAACACCGCGAAGAACCACCTGGTCGCTCGCGGGCGTCGGCCACCGGACAGCGATGTGACC
GCAGAGGATGCGGAGTTCTTCGAGGGCGACCACGCCCTGAAGGACATCGAGTCGCCGGAACGGGCGATGTTGCGGGATGAGATCGAGGCCACCGTGCACC
AGACCATCCAGCAGTTGCCCGAGGATTTGCGCACGGCCCTGACCCTGCGCGAGTTCGAAGGTTTGAGTTACGAAGATATCGCCACCGTGATGCAGTGTCC
G