PA2492               

GENE INFORMATION
Strain Pseudomonas aeruginosa PAO1
Taxonomy ID 208964
Replicon Pseudomonas aeruginosa PAO1 chromosome, complete genome.( 5682 genes, 6264404 bp)
REFSEQ
Gene Name mexT
Alternate Gene Names
Locus Tag PA2492 (5 updates)
GI
Genomic location 2807469 - 2808512 (+ strand)
Feature Type gene
Transposon Mutant Available? Yes
Pseudomonas Ortholog Group POG001179 

PRODUCT INFORMATION
Product Name transcriptional regulator MexT (Class 1)
Alternate Product Names
Subcellular localization
Cytoplasmic (Class 2)
Cytoplasmic (Class 3)
Charge at pH 7 (Predicted)6.19
Kyte-Doolittle Hydropathy Score (Predicted)-0.405
Molecular Weight (Predicted)38.2 kDa
Isoelectric Point (Predicted)10.02

SECONDARY GENOMIC FEATURES CONTAINED IN PA2492
Type Name Start Stop Strand PubMed IDs External DB Other Notes
motif -35 region
2807473 2807478 - 10515918 PRODORIC: PT000008
transposon_insertion_site Confirmed ISlacZ/hah insertion site
2807624 2807624 + 14617778 UWGC: 8076
transposon_insertion_site Confirmed ISlacZ/hah insertion site
2807624 2807624 + 14617778 UWGC: 8280

ALTERNATE ANNOTATIONS AND CROSS-REFERENCES
GI 15597688
RefSeq NP_251182
TIGR NTL03PA02492
UniProtKB Acc Q9I0Z0
UniProtKB ID Q9I0Z0_PSEAE
Affymetrix PA2492_mexT_at
KEGG PA2492

FUNCTION CLASSIFICATION
PseudoCAP Function Class

GENE ONTOLOGY
Term Type GO Accession GO Term Evidence
Code
Reviewed
by curator?
Reference
biological_process GO:0006355 regulation of transcription, DNA-templated IDA No
biological_process GO:0045893 positive regulation of transcription, DNA-templated IEA No
biological_process GO:0050709 negative regulation of protein secretion IMP Yes PMID:21075931
biological_process GO:0045861 negative regulation of proteolysis IMP Yes PMID:21075931
biological_process GO:1900377 negative regulation of secondary metabolite biosynthetic process IMP Yes PMID:21075931

COG PREDICTION

HOMOLOGY
100% similar to a region of MexT protein [Pseudomonas aeruginosa]

STRUCTURE FEATURES
PS00044: Bacterial regulatory proteins, lysR family signature

CDD PREDICTIONS
CDD Accession External Accession Database Short Name Description Start Stop E-value Release Number
223656 COG0583 COG LysR Transcriptional regulator [Transcription] 80 337 1e-17 3.10
181918 PRK09508 PRK leuO leucine transcriptional activator; Reviewed 80 343 1e-12 3.10
217576 pfam03466 Pfam LysR_substrate LysR substrate binding domain 144 337 1e-08 3.10
176153 cd08464 CD PBP2_DntR_like_2 The C-terminal substrate binding domain of an uncharacterized LysR-type transcriptional regulator similar to DntR, which is involved in the catabolism of dinitrotoluene; contains the type 2 periplasmic binding fold 144 340 6e-55 3.10
 

SEQUENCES
>500 BP region upstream of PA2492 (Pseudomonas aeruginosa PAO1)
ATAGGCCACCAGCAGGCCGGTGTAGTAGACGCTGGCCTCCACCGGGGTGAGTACCTCGGGGTAGACCGCCAGGGCCGCGCGCGGCATCAG CACCACGTCGCCATAGGCCGGATAATGATCGGGGGTATGGGCGGGGAAACTGGCCACGCGGGAACCCAGCGGCAGGTCGCCGACGCCGGC GCCGACCGCCAGCACCTCGCCGGCCAGTTCGAAGCCGAGACCGGACGGCAGCGCAGCCTGCTCCGGGGCCAGGTTCTGACGCCAGAGCAC ATCCTTCCAGCTCACGCCGATCGCCTGGACACGCACCAGGACTTCCCCTGCGGCCGGCGCCGGGGTCGGCAGCTCTTCGCATTTGAGGAC CTCTGGCGGGCCAAACTGATGAAAACGGATCACTCGGGACATCGCAAACCTCTGCAGTGCATCACGGGGTGAATAACCTCATGGGTTGTG ACTGTATCCGCCCATGCCTGACAAAACCACCCGTCGTTATTGATAATGGCT
>PA2492 (Pseudomonas aeruginosa PAO1)
ATGCCTGTCAGTGATCCTATGCCCCTCCGGCACCTCGCCAGGCCCCGCCCCGTCTCGCACGCAAGGCTTGACGGCGAGCCCCCGCGGTTG CAGCCTCTAGCCCCTGGAAACGAGGAACGCCATGAACCGAAACGACCTGCGCCGCGTCGATCTGAACCTGCTGATCGTGTTCGAGACCCT GATGCACGAACGCAGCGTGACCCGCGCCGCAGAGAAACTGTTCCTCGGCCAGCCGGCCAGCCGGCCATCAGCGCCGCGCTGTCGCGCCTG CGCACGCTGTTCGACGACCCGCTGTTCGTCCGTACCGGACGCAGCATGGAGCCCACCGCGCGAGCCCAGGAAATCTTCGCCCACCTGTCG CCGGCGCTGGATTCCATCTCCACCGCCATGAGTCGCGCCAGCGAGTTCGATCCGGCGACCAGCACCGCGGTGTTCCGCATCGGCCTTTCC GACGACGTCGAGTTCGGCCTGTTGCCGCCCCTGCTCCGCCGCCTGCGCGCGGAGGCGCCGGGGTTCGTCCTCGTCGTGCGCCGCGCCAAC TATCTATTGATGCCGAACCTGCTGGCCTCGGGGGAGATCTCGGTGGGCGTCAGCTACACCGACGAACTGCCGGCCAACGCCAAGCGCAAG ACCGTGCGCCGCAGCAAGCCGAAGATCCTCCGCGCCGACTCCGCGCCCGGCCAGCTGACCCTCGACGACTATTGCGCGCGACCGCACGCG CTGGTGTCCTTCGCCGGCGACCTCAGCGGCTTCGTCGACGAGGAGCTGGAAAAATTCGGCCGCAAGCGCAAGGTGGTCCTGGCGGTGCCG CAGTTCAACGGCCTCGGCACCCTCCTGGCCGGCACCGACATCATCGCCACCGTGCCCGACTACGCCGCCCAGGCGCTGATCGCCGCCGGC GGCCTACGCGCCGAGGACCCACCGTTCGAGACCCGGGCCTTCGAACTGTCGATGGCTTGGCGCGGCGCCCAGGACAACGATCCGGCCGAA CGCTGGCTGCGCTCGCGGATCAGCATGTTCATCGGCGATCCGGACAGTCTCTGA
>500 BP region downstream of PA2492 (Pseudomonas aeruginosa PAO1)
GCCCTCCGGCAGCTACCCGCACGAGGCGTCGCAACGGGAAAATCGATCGCGCGCCGCGGGTGTGCGGCTTATTCCATCGAAAGCACTGTC CATAACCATCGACTGTTACAGAAAACGAAAAACCATGTATCACTGTTCGTGATAATCAAAATCTCGTCGTTCGATTAGTTCCCTGCCGGA GCAGCCCGCAGACTTCGCCAATCCCGAAAAACCGACTGGCGGAGTCAAGCATGGAACAGTCATCCCACTTCTCCTGGCGCTACCCCCTCG CACTCGCGGCCGTACTGGTCCTGAGCGCCTGCGGCAAGGCCCCGGAAACCACCCAAGGCATGGCGGCGCCCAAGGTCAGCGTCGCCGAAG TCATCGAACAACCGCTGAACGAGTGGGACGAATTCACCGGCCGCCTGGAGGCCCCGGAGTCGGTGGAGCTGCGCCCGCGGGTGTCGGGCT ACATCGACCGCGTGGCCTTCCATGAAGGCGCACTGGTGAAGAAAGGCGACC

SNPS
Showing SNPs occurring in PA2492 gene of , Pseudomonas aeruginosa PAO1 chromosome, complete genome. (2807469 to 2808512 bp)
Displaying the first five SNPs out of a total of 75 found in all isolate strains
Strain Type Mutation Description Effect Details
DNA Protein
Pseudomonas aeruginosa PA7 Transition g.2807495C>T
Not determined
CTC(Leu) -> ()
SNP136-2807495-149
Pseudomonas aeruginosa PA7 Transition g.2807516C>T
Not determined
CGC(Arg) -> ()
SNP136-2807516-149
Pseudomonas aeruginosa PA7 Indel g.2807529delG
1 BP Deletion
INDEL136-2807532-149
Pseudomonas aeruginosa PA7 Transition g.2807532A>G
Not determined
AGG(Arg) -> ()
SNP136-2807532-149
Pseudomonas aeruginosa 39016 Transition g.2807646C>T p.Pro60Thr
Missense
CCT(Pro) -> ACT(Thr)
SNP136-2807646-221

SNP MAP


REFERENCES
Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa.
Köhler T, Michéa-Hamzehpour M, Henze U, Gotoh N, Curty LK, Pechère JC.
Mol Microbiol. 1997 Jan;23(2):345-54.
PMID: 9044268
MexT regulates the type III secretion system through MexS and PtrC in Pseudomonas aeruginosa.
Jin Y, Yang H, Qiao M, Jin S.
J Bacteriol. 2011 Jan;193(2):399-410.
PMID: 21075931